Plasmid Preparation:Article Title: Molecular profiling of brain endothelial cell to astrocyte endfoot communication in mouse and human
Article Snippet: The pUCmini-iCAP-PHP.eb plasmid used for the adeno-associated AAV capsids was kindly shared by Dr. Viviana Gradinaru (Addgene Cat# 103005). .. The pZac2.1-GfaABC 1 D-tdTomato plasmid used as the control AAV was kindly shared by Dr. Baljit S. Khakh (Addgene Cat# 44332). pZac2.1-GfaABC1D-GFP was generated by excising GFP with BamHI from pZac2.1-GfaABC1D-AQP4-GFP, a gift from Dr. Baljit S. Khakh, and amplifying with the following primers before inserting into the BamHI site of the pZac2.1-GfaABC1D vector using the In-fusion® HD Cloning kit (Takara Cat# 639650): Forward: 5’ CCTCGAGCTCGGATCCGCCACCATGGTGAGCAAGGGCGAGGAG 3’; Reverse: 5’ TAAGCGAATTGGATCCTTACTTGTACAGCTCGTCCAT 3’. .. CMV-V5-TurboID-NES-pCDNA3 was kindly shared by Dr. Alice Ting (Addgene Cat# 107169) and we cloned the cDNA of the TurboID enzyme gene into a pZac2.1 plasmid containing the astrocyte specific promoter GfaABC 1 D. To do so, the sequence containing the V5 Tag-TurboID-HA Tag-nuclear export signal (NES) was amplified by PCR using the following primers: Forward: 5’ CCTCGAGCTCGGATCCATGGGCAAGCCCATCCCCAA 3’; Reverse: 5’ TAAGCGAATTGGATCCTTAGTCCAGGGTCAGGCGCTCCAGGGG 3’.
Control:Article Title: Molecular profiling of brain endothelial cell to astrocyte endfoot communication in mouse and human
Article Snippet: The pUCmini-iCAP-PHP.eb plasmid used for the adeno-associated AAV capsids was kindly shared by Dr. Viviana Gradinaru (Addgene Cat# 103005). .. The pZac2.1-GfaABC 1 D-tdTomato plasmid used as the control AAV was kindly shared by Dr. Baljit S. Khakh (Addgene Cat# 44332). pZac2.1-GfaABC1D-GFP was generated by excising GFP with BamHI from pZac2.1-GfaABC1D-AQP4-GFP, a gift from Dr. Baljit S. Khakh, and amplifying with the following primers before inserting into the BamHI site of the pZac2.1-GfaABC1D vector using the In-fusion® HD Cloning kit (Takara Cat# 639650): Forward: 5’ CCTCGAGCTCGGATCCGCCACCATGGTGAGCAAGGGCGAGGAG 3’; Reverse: 5’ TAAGCGAATTGGATCCTTACTTGTACAGCTCGTCCAT 3’. .. CMV-V5-TurboID-NES-pCDNA3 was kindly shared by Dr. Alice Ting (Addgene Cat# 107169) and we cloned the cDNA of the TurboID enzyme gene into a pZac2.1 plasmid containing the astrocyte specific promoter GfaABC 1 D. To do so, the sequence containing the V5 Tag-TurboID-HA Tag-nuclear export signal (NES) was amplified by PCR using the following primers: Forward: 5’ CCTCGAGCTCGGATCCATGGGCAAGCCCATCCCCAA 3’; Reverse: 5’ TAAGCGAATTGGATCCTTAGTCCAGGGTCAGGCGCTCCAGGGG 3’.
Bioprocessing:Article Title: Molecular profiling of brain endothelial cell to astrocyte endfoot communication in mouse and human
Article Snippet: The pUCmini-iCAP-PHP.eb plasmid used for the adeno-associated AAV capsids was kindly shared by Dr. Viviana Gradinaru (Addgene Cat# 103005). .. The pZac2.1-GfaABC 1 D-tdTomato plasmid used as the control AAV was kindly shared by Dr. Baljit S. Khakh (Addgene Cat# 44332). pZac2.1-GfaABC1D-GFP was generated by excising GFP with BamHI from pZac2.1-GfaABC1D-AQP4-GFP, a gift from Dr. Baljit S. Khakh, and amplifying with the following primers before inserting into the BamHI site of the pZac2.1-GfaABC1D vector using the In-fusion® HD Cloning kit (Takara Cat# 639650): Forward: 5’ CCTCGAGCTCGGATCCGCCACCATGGTGAGCAAGGGCGAGGAG 3’; Reverse: 5’ TAAGCGAATTGGATCCTTACTTGTACAGCTCGTCCAT 3’. .. CMV-V5-TurboID-NES-pCDNA3 was kindly shared by Dr. Alice Ting (Addgene Cat# 107169) and we cloned the cDNA of the TurboID enzyme gene into a pZac2.1 plasmid containing the astrocyte specific promoter GfaABC 1 D. To do so, the sequence containing the V5 Tag-TurboID-HA Tag-nuclear export signal (NES) was amplified by PCR using the following primers: Forward: 5’ CCTCGAGCTCGGATCCATGGGCAAGCCCATCCCCAA 3’; Reverse: 5’ TAAGCGAATTGGATCCTTAGTCCAGGGTCAGGCGCTCCAGGGG 3’.
Generated:Article Title: Molecular profiling of brain endothelial cell to astrocyte endfoot communication in mouse and human
Article Snippet: The pUCmini-iCAP-PHP.eb plasmid used for the adeno-associated AAV capsids was kindly shared by Dr. Viviana Gradinaru (Addgene Cat# 103005). .. The pZac2.1-GfaABC 1 D-tdTomato plasmid used as the control AAV was kindly shared by Dr. Baljit S. Khakh (Addgene Cat# 44332). pZac2.1-GfaABC1D-GFP was generated by excising GFP with BamHI from pZac2.1-GfaABC1D-AQP4-GFP, a gift from Dr. Baljit S. Khakh, and amplifying with the following primers before inserting into the BamHI site of the pZac2.1-GfaABC1D vector using the In-fusion® HD Cloning kit (Takara Cat# 639650): Forward: 5’ CCTCGAGCTCGGATCCGCCACCATGGTGAGCAAGGGCGAGGAG 3’; Reverse: 5’ TAAGCGAATTGGATCCTTACTTGTACAGCTCGTCCAT 3’. .. CMV-V5-TurboID-NES-pCDNA3 was kindly shared by Dr. Alice Ting (Addgene Cat# 107169) and we cloned the cDNA of the TurboID enzyme gene into a pZac2.1 plasmid containing the astrocyte specific promoter GfaABC 1 D. To do so, the sequence containing the V5 Tag-TurboID-HA Tag-nuclear export signal (NES) was amplified by PCR using the following primers: Forward: 5’ CCTCGAGCTCGGATCCATGGGCAAGCCCATCCCCAA 3’; Reverse: 5’ TAAGCGAATTGGATCCTTAGTCCAGGGTCAGGCGCTCCAGGGG 3’.
Cloning:Article Title: Molecular profiling of brain endothelial cell to astrocyte endfoot communication in mouse and human
Article Snippet: The pUCmini-iCAP-PHP.eb plasmid used for the adeno-associated AAV capsids was kindly shared by Dr. Viviana Gradinaru (Addgene Cat# 103005). .. The pZac2.1-GfaABC 1 D-tdTomato plasmid used as the control AAV was kindly shared by Dr. Baljit S. Khakh (Addgene Cat# 44332). pZac2.1-GfaABC1D-GFP was generated by excising GFP with BamHI from pZac2.1-GfaABC1D-AQP4-GFP, a gift from Dr. Baljit S. Khakh, and amplifying with the following primers before inserting into the BamHI site of the pZac2.1-GfaABC1D vector using the In-fusion® HD Cloning kit (Takara Cat# 639650): Forward: 5’ CCTCGAGCTCGGATCCGCCACCATGGTGAGCAAGGGCGAGGAG 3’; Reverse: 5’ TAAGCGAATTGGATCCTTACTTGTACAGCTCGTCCAT 3’. .. CMV-V5-TurboID-NES-pCDNA3 was kindly shared by Dr. Alice Ting (Addgene Cat# 107169) and we cloned the cDNA of the TurboID enzyme gene into a pZac2.1 plasmid containing the astrocyte specific promoter GfaABC 1 D. To do so, the sequence containing the V5 Tag-TurboID-HA Tag-nuclear export signal (NES) was amplified by PCR using the following primers: Forward: 5’ CCTCGAGCTCGGATCCATGGGCAAGCCCATCCCCAA 3’; Reverse: 5’ TAAGCGAATTGGATCCTTAGTCCAGGGTCAGGCGCTCCAGGGG 3’.
|
Addgene inc is a verified supplier 